circad | circRNAs associated with diseases

hsa_circ_0001982
Gene	RNF111	Organism	Human
Genome Locus	chr15:59323002-59323901:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	28933584
Experimental Method
Sample Type	Tissues	Comparison	29 breast cancer tissues and adjacent normal tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Upregulated,7.74 pvalue : p<0.05
Citation
Tang, YY, Zhao, P, Zou, TN, Duan, JJ, Zhi, R, Yang, SY, Yang, DC, Wang, XL (2017). Circular RNA hsa_circ_0001982 Promotes Breast Cancer Cell Carcinogenesis Through Decreasing miR-143. DNA Cell Biol., 36, 11:901-908.